View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_22 (Length: 371)
Name: NF3039_low_22
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 238; Significance: 1e-131; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 238; E-Value: 1e-131
Query Start/End: Original strand, 108 - 352
Target Start/End: Complemental strand, 45365808 - 45365563
Alignment:
| Q |
108 |
aagcctcagtgccagtaggttttgtggaggtcttttatttggtttcggttttctgcttgtgagttggcgtgtgaccttctttcctttgctttcggatggt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45365808 |
aagcctcagtgccagtaggttttgtggaggtcttttatttggtttcggttttctgcttgtgagttggcgtgtgaccttctttcctttgctttcggatggt |
45365709 |
T |
 |
| Q |
208 |
ttggtggatagtttctgggctcatttt-gggttcaggttgtattgagatgagcaattgttcaccgttttgagcgctgctctttggccttttggttcattt |
306 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45365708 |
ttggtggatagtttctgggctcattttggggttcaggttgtattgagatgagcaattgttcaccgttttgagcgctgctctttggccttttggttcattt |
45365609 |
T |
 |
| Q |
307 |
gtgttgggtagctacatgtgtagagttggttcttttgtagttggtt |
352 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45365608 |
gtgttgggtagctacatgtgtagagttggttcttttgtagttggtt |
45365563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University