View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_34 (Length: 281)
Name: NF3039_low_34
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_34 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 30 - 276
Target Start/End: Complemental strand, 16504 - 16258
Alignment:
| Q |
30 |
aagatcattttgaagtttcgctacaatgaccaaatcgtgttatgtgtacaatctcaaagactaaactggcggtactttcaaataaccctatagtctcgat |
129 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16504 |
aagatcattttgaaatttcgctacaatgaccaaatcgtgttatgtgtacaatctcaaagactaaactggcggtactttcaaataaccctatagtctcgat |
16405 |
T |
 |
| Q |
130 |
taagatgtttgatgctgcatacagtgagagttaaacctctcggaggatccactacttcattgaattgcacatctctaaaacataacggttttccagtact |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16404 |
taagatgtttgatgctgcatacagtgagagttaaacctctcggaggatccactacttcattgaattgcacatctctaaaacattacggttttccagtact |
16305 |
T |
 |
| Q |
230 |
tattaagaaataatgactgtttagcatctttatggatttcctctgtg |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
16304 |
tattaagaaataatgactgtttagcatctttatggatttcctgtgtg |
16258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University