View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_43 (Length: 252)
Name: NF3039_low_43
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_43 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 15 - 113
Target Start/End: Original strand, 27755878 - 27755978
Alignment:
| Q |
15 |
cttttaacctatgcattca--ttctgtgtatttggttttgacataggggtttctcgtcgtccgctatagtgcacttcagtatactatattatttatcact |
112 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
27755878 |
cttttaacctatgcattcaatttctgtgtatttggttttgacataggggtttctcgtcgtccactatagtgcacttcagtatactatattacttatcact |
27755977 |
T |
|
| Q |
113 |
t |
113 |
Q |
| |
|
| |
|
|
| T |
27755978 |
t |
27755978 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 193 - 243
Target Start/End: Original strand, 27756001 - 27756051
Alignment:
| Q |
193 |
tgtaaattacttctatttgttgattatatgaagttgcaattttgatctctg |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
27756001 |
tgtaaattacttctatttgttgattatatgaagttacaattttgatctctg |
27756051 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University