View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_55 (Length: 240)
Name: NF3039_low_55
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_55 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 14 - 224
Target Start/End: Original strand, 31455887 - 31456097
Alignment:
| Q |
14 |
ataccatattttgaatttctttgactgtaaatacatagaactaattaatgttctttgaatatgagtcttgaaaatgcatgaaaactatgcagtatttttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31455887 |
ataccatattttgaatttctttgactgtaaatacatagaactaattaatgctctttgaatacgagtcttgaaaatgcatgaaaactatgcagtatttttt |
31455986 |
T |
 |
| Q |
114 |
ttcttaattaaaactttgtactcactgtaacagcaattgcgtgccaggnnnnnnnttaaagctcttttctcaagctattgtttctccagaaattagttaa |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31455987 |
ttcttaattaaaactttgtactcactgtaacagcaattgcgtgcgaggaaaaaaattaaagctcttttctcaagctattatttctccagaaattagttaa |
31456086 |
T |
 |
| Q |
214 |
gaggagtatat |
224 |
Q |
| |
|
||||||||||| |
|
|
| T |
31456087 |
gaggagtatat |
31456097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University