View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_59 (Length: 237)
Name: NF3039_low_59
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 30190643 - 30190857
Alignment:
| Q |
1 |
tgcaagaccatattccttgtggtcaaaatgtagtcgtcaccaagnnnnnnngagaccatattcaatatttggcattttataagcagatgtactttaaagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30190643 |
tgcaagaccatattccttgtggtcaaaatgtagtcgtcaccaagaaaaaaagagaccatattcaatatttggcattttataagcagatgtactttaaagt |
30190742 |
T |
|
| Q |
101 |
caacgcttttttcctgttaccctacttacatgaacatgtaattcatgaatttcttgggaacttataacattactgcatacgaagcttatacatattcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30190743 |
caacgcttttttcctgttaccctacttacatgaacatggaattcatgaatttcttgggaacttataacattactgcatacgaagcttatacatattcatt |
30190842 |
T |
|
| Q |
201 |
tatgggtttgtctaa |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30190843 |
tatgggtttgtctaa |
30190857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University