View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3039_low_68 (Length: 217)

Name: NF3039_low_68
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3039_low_68
NF3039_low_68
[»] chr5 (1 HSPs)
chr5 (18-208)||(195941-196131)


Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 196131 - 195941
Alignment:
18 gttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaacggttaattggttaataaagagata 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
196131 gttggggaagtcagttactcagctctggactgactacaaaactaagtatatggcagtggcaccaactaactagaatggttaattggttaataaagagata 196032  T
118 atgcattgggatagttaataaccgtgcatgccattaaggttttacatttggtttctatattttaatttcatgttatgtcattcatctcact 208  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
196031 atgcattgggatagttaataaccgtgcatgccattaaggttttacatttggtttctatattttaatttcatgttatgtcattcagctcact 195941  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University