View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3039_low_70 (Length: 211)
Name: NF3039_low_70
Description: NF3039
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3039_low_70 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 20 - 195
Target Start/End: Complemental strand, 544514 - 544339
Alignment:
| Q |
20 |
tcaatctcttcctctcttattgattcgtgggtttttgatctcatcatacccttcaccatttttcatttgatctgggnnnnnnncttcccttttctattga |
119 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
544514 |
tcaatctcttcctcttttattgattcgtgggtttttgatctcatcatacccttcaccatttttcatttgatctgggtttttttcttcccttttctattga |
544415 |
T |
|
| Q |
120 |
ttgtcatgttattctaggttattgaattgttgggccattgaaattttgtagataaccatacaatccttcttctgtg |
195 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
544414 |
ttgtcctgttattctaggttattgaattgttgggccattgaaattttgtagataaccatacaatccttcttctgtg |
544339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 27 - 79
Target Start/End: Original strand, 22496488 - 22496540
Alignment:
| Q |
27 |
cttcctctcttattgattcgtgggtttttgatctcatcatacccttcaccatt |
79 |
Q |
| |
|
|||||| ||||| ||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
22496488 |
cttcctttcttagcgattcatggggttttgatctcatcatactcttcaccatt |
22496540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University