View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3040R-Insertion-3 (Length: 127)
Name: NF3040R-Insertion-3
Description: NF3040R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3040R-Insertion-3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 2e-56; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 2e-56
Query Start/End: Original strand, 9 - 127
Target Start/End: Complemental strand, 46915111 - 46914993
Alignment:
| Q |
9 |
aaaaccttatacggtctaattcccttgaccaaccccaactaaatttgaggtatatcattgtctctatgacctagctaaagactagagcttatagcatttg |
108 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46915111 |
aaaaccttatacggtctatttcccttgaccaacccccactaaatttgaggtatatcattgtctctatgacctagctaaagactagagcttatagcatttg |
46915012 |
T |
|
| Q |
109 |
gatcatctacctccactgc |
127 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
46915011 |
gatcatctacctccactgc |
46914993 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University