View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3040R-Insertion-4 (Length: 137)
Name: NF3040R-Insertion-4
Description: NF3040R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3040R-Insertion-4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 117; Significance: 5e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 117; E-Value: 5e-60
Query Start/End: Original strand, 9 - 129
Target Start/End: Original strand, 8361835 - 8361955
Alignment:
| Q |
9 |
ccaagatatcagcacaagacacgacccctggacaaactgcttccaatgctttcttagcattatcaattacataaaatgcatgcaatgatatgtttggagg |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8361835 |
ccaaaatatcagcacaagacacgacccctggacaaactgcttccaatgctttcttagcattatcaattacataaaatgcatgcaatgatatgtttggagg |
8361934 |
T |
|
| Q |
109 |
tccatccttttctgctttatt |
129 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8361935 |
tccatccttttctgctttatt |
8361955 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 48; Significance: 8e-19; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 48; E-Value: 8e-19
Query Start/End: Original strand, 47 - 126
Target Start/End: Original strand, 9058591 - 9058670
Alignment:
| Q |
47 |
gcttccaatgctttcttagcattatcaattacataaaatgcatgcaatgatatgtttggaggtccatccttttctgcttt |
126 |
Q |
| |
|
||||| ||||||||||| || | |||||| ||||| |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
9058591 |
gcttctaatgctttctttgcttcatcaatgacatagaatgcatgcaatgaaatgtttggcggtccatccttttctgcttt |
9058670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.00000000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.00000000000005
Query Start/End: Original strand, 11 - 126
Target Start/End: Complemental strand, 31748182 - 31748067
Alignment:
| Q |
11 |
aagatatcagcacaagacacgacccctggacaaactgcttccaatgctttcttagcattatcaattacataaaatgcatgcaatgatatgtttggaggtc |
110 |
Q |
| |
|
||||||||||||||||| || || || || ||| | ||||| ||||||||||| ||||||||||| | | | ||||||||||| ||| ||||| |||| |
|
|
| T |
31748182 |
aagatatcagcacaagagactacaccagggcaagcagcttctaatgctttctttgcattatcaatgataaagaatgcatgcaaagatgcatttggtggtc |
31748083 |
T |
|
| Q |
111 |
catccttttctgcttt |
126 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
31748082 |
catctttttctgcttt |
31748067 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University