View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3040R-Insertion-5 (Length: 165)
Name: NF3040R-Insertion-5
Description: NF3040R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3040R-Insertion-5 |
 | |
|
| [»] chr5 (1 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 133; Significance: 2e-69; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 26 - 165
Target Start/End: Original strand, 40642676 - 40642816
Alignment:
| Q |
26 |
ataattgcatacaaaaacaaaattatagtgaaatgataactaagtacttaataaaaaattataaactacgaatag-aaaacattgctaatgattgttcat |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
40642676 |
ataattgcatacaaaaacaaaattatagtgaaatgataactaagtacttaataaaaaattataaactacgaatagaaaaacattgctaatgattgttcat |
40642775 |
T |
|
| Q |
125 |
ctgaaccattgttggatacattaatttcattatgttcctcc |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40642776 |
ctgaaccattgttggatacattaatttcattatgttcctcc |
40642816 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University