View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3040R-Insertion-7 (Length: 255)
Name: NF3040R-Insertion-7
Description: NF3040R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3040R-Insertion-7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 8 - 158
Target Start/End: Original strand, 53493466 - 53493616
Alignment:
| Q |
8 |
agatagacaagtatatattgtggatttttccaaatcttcatcgttgaagttaataccattgtctatgttaaactttttgggtatgcgagtggatttggtt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53493466 |
agatagacaagtatatattgtggatttttccaaatcttcatcgttgaagttaataccattgtctatgttaaactttttgggtatgcgagtggatttggtt |
53493565 |
T |
 |
| Q |
108 |
caaaatgaaataacgcagttgacaaatacattgagtcagtgcacactgcac |
158 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
53493566 |
caaaatgaaataacacagttgacaaatacattgagtcagtgtacactgcac |
53493616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University