View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3040_low_2 (Length: 313)
Name: NF3040_low_2
Description: NF3040
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3040_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 15 - 278
Target Start/End: Complemental strand, 45580402 - 45580139
Alignment:
| Q |
15 |
atatcatgatatataatattttatataatttcgtttgattgtttatgttgttgattcgaattatcttatatgcagcagttctcttcattcgttcgttatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45580402 |
atatcatgatatataatattttatataatttcgtttgattgtttatgttgttgattcgaattatcttatatgcagcagttctcttcattcgttcgttatt |
45580303 |
T |
 |
| Q |
115 |
taccaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagnnnnnnntggcagaactgagt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
45580302 |
taccaatttcaaatccctaaccctaaccccccaaaacctaattcttgtcattttattttgtgttattaacagtgtgaagaaaaaaatggcagaactgagt |
45580203 |
T |
 |
| Q |
215 |
ttgggaattctaattgacatcgttgattaggattggatgagagacactcttcctcaagatggta |
278 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
45580202 |
ttgggaattctaattgacatcgttgatgaggattggatgagagacactcttcctcaagatggta |
45580139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University