View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_high_27 (Length: 222)
Name: NF3041_high_27
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_high_27 |
 | |
|
| [»] scaffold0148 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0148 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: scaffold0148
Description:
Target: scaffold0148; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 5 - 207
Target Start/End: Original strand, 28193 - 28395
Alignment:
| Q |
5 |
aattgatcatgctttccgtgctcttcgctctcccaatgaatttcacttcggtttaagatgatgaaacggttgtccattgtcttaaaagtgaaatccccac |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28193 |
aattgatcatgctttccgtgctcttcgctctcccaatgaatttcacttcggtttaagatgatgaaacggttgtccattgtcttaaaagtgaaatccccac |
28292 |
T |
|
| Q |
105 |
tgcttgggtcatcagcacctttccaactagtcagactcaaattcttatccatattcattccaagtaggaatgtgtcagttggattttcaaagctctccca |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28293 |
tgcttgggtcatcagcacctttccaactagtcagactcaaattcttatccatattcattccaagtaggaatgtgtcagttggattttcaaagctctccca |
28392 |
T |
|
| Q |
205 |
cag |
207 |
Q |
| |
|
||| |
|
|
| T |
28393 |
cag |
28395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University