View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_low_13 (Length: 341)
Name: NF3041_low_13
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 20 - 329
Target Start/End: Complemental strand, 28936707 - 28936397
Alignment:
| Q |
20 |
tttggcttctgttgttcacaatggcatccaaactccattgaatcacactgaccttatcaagatcagggcttcgcattccaaaacctccacactccaattc |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28936707 |
tttggcttctgttgttcacaatggcatccaaactccattgaatcatactgaccttatcaggatcagggcttcgcattccaaaacctccacactccaattc |
28936608 |
T |
 |
| Q |
120 |
cttcaccgtcctatctcttctttttcctcaggtattctccatct------ctctctcctccaaattcatcttcttaattacttctttacccctgatcgca |
213 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28936607 |
cttcaccgtcctatctcttccttttcctcaggtattctccatctctctatctctctcctctaaattcatcttcttaattacttctttacccctgatcgca |
28936508 |
T |
 |
| Q |
214 |
nnnnnnnnnnnnnnnnnnatgtgtttgtggtggcagtgtatcatttacatcgtcctctccgtctcccacttccatgctccaaaccaattcgtcaggttca |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28936507 |
-----tttttttttttttatgtgtttgtggtggcagtgtatcatttacatcgtcctctccgtctcccacttccatgctccaaaccaattcgtcaggttca |
28936413 |
T |
 |
| Q |
314 |
tccatttcatacttca |
329 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
28936412 |
tccatttcatacttca |
28936397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University