View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_low_18 (Length: 281)
Name: NF3041_low_18
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 19 - 272
Target Start/End: Complemental strand, 54840698 - 54840440
Alignment:
| Q |
19 |
ggggggtcatttcaaggggtatttaaaaacatgactttgaattgttagaaaacaatggtttaaattgaatttgttaagattgagtttaaagataatggat |
118 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54840698 |
ggggggtcatttcaatgggtatttaaaaacatgactttgaattgttagaaaacaatggtttaaattgaatttgttaagattgagtttaaagataatggat |
54840599 |
T |
 |
| Q |
119 |
ttatgatagaatgtttttactctga-----aaatttgatgtaaaatttacgatgcaacacaagaatagccgttttatcccttttggtcgataaaattgtg |
213 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54840598 |
ttatgatagaatgtttttactctaaaaatgaaatttgatgtaaaatttacgatgcaacacaagaatagccgttttatcccttttggtcgataaaattgtg |
54840499 |
T |
 |
| Q |
214 |
gcacaaacaaacaactttgactatatatcaacaaaaatgtatactatgatgatgatgat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54840498 |
gcacaaacaaacaactttgactatatatcaacaaaaatgtatactatgatgatgatgat |
54840440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University