View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3041_low_22 (Length: 250)

Name: NF3041_low_22
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3041_low_22
NF3041_low_22
[»] chr3 (1 HSPs)
chr3 (13-250)||(803317-803554)


Alignment Details
Target: chr3 (Bit Score: 226; Significance: 1e-125; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 226; E-Value: 1e-125
Query Start/End: Original strand, 13 - 250
Target Start/End: Complemental strand, 803554 - 803317
Alignment:
13 aaaattgaagtgaagattcatactttggggactagcttttggaaaaatattcaggagtttcatttcgatggccacactatagagggacccggacattttg 112  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
803554 aaaattgaagtgaagattcatactttggggactagcttttggaaaaatattcaggagtttcatttcgatggccacactattgagggacccggacattttg 803455  T
113 tgggtggcgcaattaattggctgagtttgaaagatttaggtatggaaaattcatgttttattatttcttttaatttgaaaaatgagtcttttcaagagat 212  Q
    ||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
803454 tgggtggcgcaattaattggcggagtttgaaagatttaggcatggaaaattcatgttttattatttcttttaatttgaaaaatgagtcttttcaagagat 803355  T
213 tttgttgcctgaccatgaagagatagatacaagtgatt 250  Q
    ||||||||||||||||||||||||||||||||||||||    
803354 tttgttgcctgaccatgaagagatagatacaagtgatt 803317  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University