View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_low_25 (Length: 238)
Name: NF3041_low_25
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_low_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 18 - 238
Target Start/End: Original strand, 8203639 - 8203860
Alignment:
| Q |
18 |
ccctattggcccattgtactctattcaactaa-tttttattaaaataaccatattacttggttaacatctaactgtnnnnnnntatagttgagtatataa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8203639 |
ccctattggcccattgtactctattcaactaaatttttattaaaataaccatattacttggttaacatctaactgtaaaaaaatatagttgagtatataa |
8203738 |
T |
 |
| Q |
117 |
tcaaacaagatattattttaaccgagatagacatgcaaagtttatacaagatannnnnnncataggtaagttctgacatgcaatattaaagagatgtttt |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8203739 |
tcaaacaagatattattttaaccgagatagacatgcaaagtttatacaagatatttttttcataggtaagtcctgacatgcaatattaaagagatgtttt |
8203838 |
T |
 |
| Q |
217 |
agcatcaaggacaagaattgat |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8203839 |
agcatcaaggacaagaattgat |
8203860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University