View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_low_31 (Length: 203)
Name: NF3041_low_31
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 24 - 183
Target Start/End: Original strand, 1924457 - 1924616
Alignment:
| Q |
24 |
ggtcaggtagccagcctagtggttagaattcaccttataaacagttttttcttctttatatctaaaataccgatcttacaatttggactgcctaatctta |
123 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
1924457 |
ggtcaggtagccagcctagtggttagaattcaccttataaacagttttttcttctttatatctaaaataccgatcttactatttggactgcctgatctta |
1924556 |
T |
 |
| Q |
124 |
accagacggtccataagtggctgaatgcgcgcagggttgtgtatttttgttagtcatgtc |
183 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1924557 |
accagacggtccataagtggctgaatgcgcgcagggttgtgtatttttgttagtcatgtc |
1924616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 24 - 63
Target Start/End: Complemental strand, 38792334 - 38792295
Alignment:
| Q |
24 |
ggtcaggtagccagcctagtggttagaattcaccttataa |
63 |
Q |
| |
|
||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
38792334 |
ggtcatgtagccagcctagtggctagaattcaccttataa |
38792295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 36 - 64
Target Start/End: Complemental strand, 40786390 - 40786362
Alignment:
| Q |
36 |
agcctagtggttagaattcaccttataaa |
64 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40786390 |
agcctagtggttagaattcaccttataaa |
40786362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University