View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3041_low_8 (Length: 400)
Name: NF3041_low_8
Description: NF3041
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3041_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 94; Significance: 9e-46; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 94; E-Value: 9e-46
Query Start/End: Original strand, 34 - 171
Target Start/End: Original strand, 36446142 - 36446279
Alignment:
| Q |
34 |
agaacctgtgatactgtaaccaaaaaagaacatgtgatactacctattacttatgatactccctatccctatactattgattatatgatgtacttggttc |
133 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
36446142 |
agaacctgtgatactgtaaccaaaaaagaacctgtgatactacctattacttatgatactccctatacccatactattgattatatgatctacttggttt |
36446241 |
T |
|
| Q |
134 |
aactcttatcnnnnnnnncttagataatttaagtttgg |
171 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
36446242 |
aactcttatcttttttatcttagataatttaagtttgg |
36446279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 308 - 400
Target Start/End: Original strand, 36446387 - 36446477
Alignment:
| Q |
308 |
gcacatgttaaaatttcctttaacatgaccctaccaattttaatttgaaaaagattggaagagagtgagcaaaggagtggaacctatgatact |
400 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36446387 |
gcacatgttaaaatttcctt-aacatgaccctaccaattttaatttgaaaaagattggaagagagtgagc-aaggagtggaacctatgatact |
36446477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University