View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_high_15 (Length: 300)
Name: NF3042_high_15
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 7 - 292
Target Start/End: Complemental strand, 46261446 - 46261160
Alignment:
| Q |
7 |
gttataactttattagaagaatataacagcatatttggggtaattagatctcttgattttactttttgcatggcgcccattcataaaatgaaaccatgat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46261446 |
gttataactttattagaagaatataacagcatatttggggtaattagatctcttgattttactttttgcatggcgcccattcataaaatgaaaccatgat |
46261347 |
T |
 |
| Q |
107 |
gcatgcatctgttagactcttgcatgcatctgaatgg-attattttttattattgttattgctattttataagcatctcttcagaatcctaacttgttag |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46261346 |
gcatgcatctgttagactcttgcatgcatctgaatgggattattttttattattgttattgctattttataagcatctcttcagaatcctaacttgttag |
46261247 |
T |
 |
| Q |
206 |
tgttgtagcaggaaggctctgtgtcccctgatatatacaccgacacagaagagagtgggtctgagagtgaggaaggtactgatgatg |
292 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46261246 |
tgttgtagcaggaaggctctgtgtcccctgatatatacaccgacacagaagagagtgggtctgagagtgaggaaggtactgatgatg |
46261160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 7 - 48
Target Start/End: Original strand, 27780708 - 27780749
Alignment:
| Q |
7 |
gttataactttattagaagaatataacagcatatttggggta |
48 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
27780708 |
gttattacattattagaagaatataacagcatatttgaggta |
27780749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University