View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_high_21 (Length: 244)
Name: NF3042_high_21
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_high_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 33146262 - 33146477
Alignment:
| Q |
1 |
taagttttttgtgtcaaacacaatttgaaaatacaacccaaaatcattttaacaggcaaaacatactcacattgtgatgaatgaccttcctcggaagtat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33146262 |
taagttttttgtgtcaaacacaatttgaaaatacaacccaaaatcattttaacaggcaaaacatactcacattgtgatgaatgaccttcctcggaagtat |
33146361 |
T |
 |
| Q |
101 |
gaaataagtagtctaagaatcaagaatcagtcttcattattcttccaattgttcttcaaataaattattctaagcatgatataaatatgcatgatgccaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33146362 |
gaaataagtagtctaagaatcaagaatcagtcttcattattcttccaattgttcttcaaataaattattctaagcatgatataaatatgcatgatgccaa |
33146461 |
T |
 |
| Q |
201 |
gtatgatgatcataat |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33146462 |
gtatgatgatcataat |
33146477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University