View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_low_17 (Length: 266)
Name: NF3042_low_17
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 13 - 95
Target Start/End: Complemental strand, 13462476 - 13462394
Alignment:
| Q |
13 |
aatatgatcaggctattcttaccttatgtctcaacttcagattgtcagagttcatttcttcttggaaacgaagggttaacact |
95 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
13462476 |
aatatgatcaggctattcttaccttatgtctcaacttcagattgtcagagtttattttttcttggaaacgaagggttaacact |
13462394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 149 - 251
Target Start/End: Complemental strand, 13462329 - 13462224
Alignment:
| Q |
149 |
caacatgaagaaatgaattttgtttagtgaatgaaattaatggctttaatgggtaaatatatg---tannnnnnnaaagcaagaatgggtaaatatatgt |
245 |
Q |
| |
|
||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||||||||||||||||| |
|
|
| T |
13462329 |
caacatggagaactgaattttgtttagtgaatgaaattaatggctttaatgggtaaatatatgtattatttttttaaagaaagaatgggtaaatatatgt |
13462230 |
T |
 |
| Q |
246 |
tgttat |
251 |
Q |
| |
|
|||||| |
|
|
| T |
13462229 |
tgttat |
13462224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 171 - 212
Target Start/End: Complemental strand, 31291083 - 31291042
Alignment:
| Q |
171 |
tttagtgaatgaaattaatggctttaatgggtaaatatatgt |
212 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
31291083 |
tttagtgaatgaaatcaatggctttaatgggtaaatacatgt |
31291042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University