View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_low_20 (Length: 246)
Name: NF3042_low_20
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_low_20 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 18 - 246
Target Start/End: Complemental strand, 23380099 - 23379872
Alignment:
| Q |
18 |
aagggttgatttttatttagggtagtgcacacgagataggtatattgatttattctttgacggtatgattggccatatagatggaaatatcataattcac |
117 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23380099 |
aagggttgatttttatttagggcagtgcacacgagataggtatattgatttattctttgacggtatgattggccatatagatggaaatatcataattcac |
23380000 |
T |
|
| Q |
118 |
tgatactggtagtatataatgtaatacttctcattcttttaannnnnnngcggttgtacttgtacattgtatacattacagtagcacaactttaaaagaa |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23379999 |
tgatactggtagtatataatgtaatacttctcattcttttaa-ttttttgcggttgtacttgtacattgtatacattacagtagcacaactttaaaagaa |
23379901 |
T |
|
| Q |
218 |
aatctaaataaagaacaacaaaacaaaac |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23379900 |
aatctaaataaagaacaacaaaacaaaac |
23379872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University