View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_low_22 (Length: 241)
Name: NF3042_low_22
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_low_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 44998831 - 44999054
Alignment:
| Q |
1 |
ttcttctgaatctgactctgacttgaaaccagtcagattcctgtgttgtgtagtagtgtatagttccttcacgaaccgtttgaacagtactttcttgccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44998831 |
ttcttctgaatctgactctgacttgaaaccagtcagattcctgtgttgtgtagtagtgtatagttccttcacgaaccgtttgaacagtactttcttgccg |
44998930 |
T |
 |
| Q |
101 |
tgacacgttcatccgaacacgtgacgactcagggactctcctaatgggtcccatcacaacttcccattcattcaactgggattttcatatgatc--atat |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
44998931 |
tgacacgttcatccgaacacgtgacgactcagggactctcctaatgggtcccatcacaacttcc----cattcaactgggattttcatatgatcatatat |
44999026 |
T |
 |
| Q |
199 |
ctccgttccgtacactttgtttgtattt |
226 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44999027 |
ctccgttccgtacactttgtttgtattt |
44999054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University