View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_low_24 (Length: 236)
Name: NF3042_low_24
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_low_24 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 107; Significance: 9e-54; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 107; E-Value: 9e-54
Query Start/End: Original strand, 105 - 219
Target Start/End: Complemental strand, 28966455 - 28966341
Alignment:
| Q |
105 |
atagtatcatatattttgcataacttgtatcatgtgctccaccctggaaaaataatggtgtacgtcctttctttgtattgctaatggctaatgctgaccc |
204 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28966455 |
atagtatcatatattttgcacaacttgtatcatgtgctccaccctggaaaaataatggtgtacgtcctttctttgtattgctaatggctaatgctgaccc |
28966356 |
T |
|
| Q |
205 |
taccaccaacaccaa |
219 |
Q |
| |
|
||||| ||||||||| |
|
|
| T |
28966355 |
taccatcaacaccaa |
28966341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University