View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3042_low_26 (Length: 206)
Name: NF3042_low_26
Description: NF3042
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3042_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 91; Significance: 3e-44; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 1 - 177
Target Start/End: Complemental strand, 55363714 - 55363538
Alignment:
| Q |
1 |
tacagggggtaaagacctattaacnnnnnnnaacaatacaccaataagttaatcaattatttatttataaaattatatgcatgattaatgaattatgaa- |
99 |
Q |
| |
|
||||||| |||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55363714 |
tacagggagtaaagacctattaactttttttaacaatacaccaataagttaatcagttatttatttataaaattatatgcatgattaatgaattatgaat |
55363615 |
T |
 |
| Q |
100 |
-tataatggagaggtttttccttaattannnnnnnnacatgaaagtctaaattagttcataaatatagttcagttggta |
177 |
Q |
| |
|
||||||||||||||||| |||||||| | |||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
55363614 |
atataatggagaggttttgccttaatt--tctttttaaatgaaagtctaaattagttcataagcatagttcagttggta |
55363538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University