View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3044_low_4 (Length: 477)
Name: NF3044_low_4
Description: NF3044
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3044_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 2e-90; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 2e-90
Query Start/End: Original strand, 286 - 458
Target Start/End: Original strand, 48402904 - 48403076
Alignment:
| Q |
286 |
ttcacaaagagtaatattctctcaaatatgatattgaatttgttcaagtgatacctgtttcggatactttcttaaactaaaaaatttcaacatttgctct |
385 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48402904 |
ttcacaaagagtgatattctctcaaatatgatattgaatttgttcaagtgatacctgtttcggatactttcttaaactaaaaaatttcaacatttgctct |
48403003 |
T |
 |
| Q |
386 |
cttgttgtcacttccttcgattcattgcacaattctatgttatactcctctttctcttcatttggtttttcat |
458 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48403004 |
cttgttgtcacttccttcgattcattgcacaattctatgttatactcctctttctcttcatttggtttttcat |
48403076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 88; E-Value: 4e-42
Query Start/End: Original strand, 1 - 92
Target Start/End: Original strand, 48402672 - 48402763
Alignment:
| Q |
1 |
cgttatggtagactaggcattcaagatgatgtccgtatgacatggtcagaaaccaaaccaccgtttttgcgatcaattataatccactagaa |
92 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
48402672 |
cgttatggtagactaggcattcaagatgatgtccgtatgacatggtcagaaaccaaaacaccgtttttgcgatcaattataatccactagaa |
48402763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 170 - 242
Target Start/End: Original strand, 48402841 - 48402913
Alignment:
| Q |
170 |
gtgagattttaaagacggtcacagaaaataacacaggaaaatacgtttggccctttaagatatttcacaaaga |
242 |
Q |
| |
|
||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48402841 |
gtgagattttagagatggtcacagaaaataacacaggaaaatacgtttggccctttaagatatttcacaaaga |
48402913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University