View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3045_low_10 (Length: 227)
Name: NF3045_low_10
Description: NF3045
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3045_low_10 |
 |  |
|
| [»] chr1 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 132; Significance: 1e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 96 - 227
Target Start/End: Original strand, 46673438 - 46673569
Alignment:
| Q |
96 |
atagaagaacaactttattaacttatctcctaatatacttcacgtcaaagttcactaaatcagagacgagcaaacgtctacgatcattgataattacact |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46673438 |
atagaagaacaactttattaacttatctcctaatatacttcacgtcaaagttcactaaatcagagacgagcaaacgtctacgatcattgataattacact |
46673537 |
T |
 |
| Q |
196 |
ataatcagactcaccttacttggtaccattat |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46673538 |
ataatcagactcaccttacttggtaccattat |
46673569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 77
Target Start/End: Original strand, 46673337 - 46673413
Alignment:
| Q |
1 |
attgaaagagagttaacaacgatacctaaagcatcgggaaaatatggtttgagataagtaaaaatggagtacctaca |
77 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
46673337 |
attgaaagagagttaacaacgatacctaaagcatcgggaaaatatggtttgagatcagtaaaaatggagtacctaca |
46673413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 144 - 204
Target Start/End: Original strand, 28324048 - 28324108
Alignment:
| Q |
144 |
agttcactaaatcagagacgagcaaacgtctacgatcattgataattacactataatcaga |
204 |
Q |
| |
|
||||| |||||||||| || || | |||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
28324048 |
agttcgctaaatcagatactagaagacgtctacaatcattgataattgcactataatcaga |
28324108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University