View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_high_15 (Length: 378)
Name: NF3047_high_15
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_high_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 241; Significance: 1e-133; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 38 - 294
Target Start/End: Complemental strand, 6497549 - 6497293
Alignment:
| Q |
38 |
aataaaattttgctatggtatataggcagtgtcgtgtgttattgcacccgtgaaatactatatatctaggcttcatagaactccagtaacagatatcaga |
137 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497549 |
aataaaattttgctatggtaactaggcagtgtcgtgtgttattgcacccgtgaaatactatatatctaggcttcatagaactccagtaacagatatcaga |
6497450 |
T |
 |
| Q |
138 |
aatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaacaagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggc |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6497449 |
aatgcaaacagaattattaattatgcacaataaaagtaatgtaaaaacaagcttcatgtcttaatggcaggttgatatctctccctgagggatgagaggc |
6497350 |
T |
 |
| Q |
238 |
aggggggctctgtgaatcaatcagttgtgcaacaaaacggataagctcaattcatgt |
294 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
6497349 |
aggggggctctgcgaatcaatcagttgtgcaacaaaacagataagctcaattcatgt |
6497293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 292 - 367
Target Start/End: Complemental strand, 6497114 - 6497039
Alignment:
| Q |
292 |
tgtgtttatcacttgttatctctagaattttcagcttatgagtaatatctcaattaagtttatatcctatgatgat |
367 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6497114 |
tgtgtttatcacttgttatctctagaattttcagcttatgagtaatatcacaattaagtttatatcctatgatgat |
6497039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 66; Significance: 4e-29; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 287 - 356
Target Start/End: Complemental strand, 31731897 - 31731828
Alignment:
| Q |
287 |
attcatgtgtttatcacttgttatctctagaattttcagcttatgagtaatatctcaattaagtttatat |
356 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31731897 |
attcatgtgttaatcacttgttatctctagaattttcagcttatgagtaatatctcaattaagtttatat |
31731828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University