View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_high_33 (Length: 250)
Name: NF3047_high_33
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_high_33 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 15054961 - 15054731
Alignment:
| Q |
22 |
gaattttttgctttagtggatactatttgatgatttggtttacataagaacttttaactttaatcagnnnnnnnnnn--cttcagaaggaaaatgtttaa |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
15054961 |
gaattttttgctttagtggatactatttgatgatttggtttacataagaacttttaactttaatcagttttttttttttcttcagaaggaaaatgtttaa |
15054862 |
T |
 |
| Q |
120 |
tttaaaaaggctcgacaaaaaccaagttgaggatttaggctaggttgttaatagtggcaaattgtgctgcgataatagagcggatcagtgggtggccgcc |
219 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
15054861 |
tttaaaaaggcttgacaaaaaccaagttgaggatttaggctaggttgttaatagtggcaaatcgtattgcgataatagagcggatcagtgggtggccgcc |
15054762 |
T |
 |
| Q |
220 |
ccaacatgctatgtatgagagtggcggccac |
250 |
Q |
| |
|
|||||||||| |||||||||||||||||||| |
|
|
| T |
15054761 |
ccaacatgctgtgtatgagagtggcggccac |
15054731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University