View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_high_36 (Length: 240)
Name: NF3047_high_36
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_high_36 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 184
Target Start/End: Complemental strand, 51939218 - 51939035
Alignment:
| Q |
1 |
cctttacttgaagtggtttcactaaattgtaatcttctttcgccacctaagcctgatgactacgagtcgcgagctgaaattaagttttgtgcttcacatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51939218 |
cctttacttgaagtggtttcactaaattgtaatcttctttcgccacctaagcctgatgactacgagtcgcgagctgaaattaagttttgtgcttcacatc |
51939119 |
T |
|
| Q |
101 |
ttacgaaattcagatatgagggtattataccatcggataacattgtgctagatgcagacatcgcttctactagtatcgggctat |
184 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
51939118 |
ttacgagattcagttatgagggtattataccatcggataacattgtgctagatgcagacatcacttctactagtatcgggctat |
51939035 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 64 - 157
Target Start/End: Complemental strand, 51944124 - 51944031
Alignment:
| Q |
64 |
gagtcgcgagctgaaattaagttttgtgcttcacatcttacgaaattcagatatgagggtattataccatcggataacattgtgctagatgcag |
157 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||||| ||||||||| ||| |||| |||| |||| |||| | ||||||||||||||| |
|
|
| T |
51944124 |
gagtcgcatgctgaaattaagctttgtgcttcacatcttaggaaattcagttatcgtggtaatatatcatcagatacctttgtgctagatgcag |
51944031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University