View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_high_37 (Length: 240)
Name: NF3047_high_37
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_high_37 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 21 - 240
Target Start/End: Original strand, 1006518 - 1006737
Alignment:
| Q |
21 |
cgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatggagccatgcactttgagagttact |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006518 |
cgaaagctgttagggtttaattattattctttagctagacttattaacgtggttgtcccgaattatgcaggaaatggagccatgcactttgagagttact |
1006617 |
T |
|
| Q |
121 |
tgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatacttcattggctgaacgtatgaaagcacttgtaaaagagtttac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1006618 |
tgcaaaggatggtaagaatggcagcaacggaccaagccgtcttagagtattataatacttcattggctgaacgtatgaaagcacttgtaaaagagtttac |
1006717 |
T |
|
| Q |
221 |
aagaattggagtcgaggact |
240 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
1006718 |
aagaattggagtcgaggact |
1006737 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 170 - 231
Target Start/End: Original strand, 1451611 - 1451672
Alignment:
| Q |
170 |
ttataatacttcattggctgaacgtatgaaagcacttgtaaaagagtttacaagaattggag |
231 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||| |||||||||| ||||||||||| |
|
|
| T |
1451611 |
ttataatagttcattggctgaacgtatgaaagcgattgtcaaagagtttataagaattggag |
1451672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 164 - 231
Target Start/End: Original strand, 52474802 - 52474869
Alignment:
| Q |
164 |
agagtattataatacttcattggctgaacgtatgaaagcacttgtaaaagagtttacaagaattggag |
231 |
Q |
| |
|
||||| |||||||| || ||||||||||||| || |||| ||||| |||||||||| |||| |||||| |
|
|
| T |
52474802 |
agagtgttataatagtttattggctgaacgtttgcaagcgcttgtcaaagagtttataagatttggag |
52474869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University