View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_low_21 (Length: 300)
Name: NF3047_low_21
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 10 - 282
Target Start/End: Original strand, 12369243 - 12369508
Alignment:
| Q |
10 |
gcagagaatggctatcgtgaaaaaagttgtagggatatgatgggttgatttgggatttaggatatgagattgattgaggtattgttagagcctatagaga |
109 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12369243 |
gcagagaatggctatagtgaaaaaagttgtagggatattatgggttgatttgggat-------atgagattgattgaggtattgttagagcctatagaga |
12369335 |
T |
 |
| Q |
110 |
attgatgtcatgatgcgggaccgcagagggaggtggcggattacaatttaggcacgtagggagaagaggaacgtgcgttcctggttatgttttctcatga |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12369336 |
attgatgtcatgatgcgggaccgcagagggaggtggcaaattacaatttaggcacgtagggagaagaggaacgtgcgttcctggttatgttttctcatga |
12369435 |
T |
 |
| Q |
210 |
attagcttttttct-nnnnnnnncaagggtgtgtcatgtggcacattctaattgggtcaatggcacacgacatt |
282 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
12369436 |
attagcttttttctaaaaaaaaacaagggtgtgtcatgtggcacactctaatt-ggtcaatggcacacgacatt |
12369508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University