View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_low_22 (Length: 298)
Name: NF3047_low_22
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_low_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 105 - 289
Target Start/End: Original strand, 40187442 - 40187626
Alignment:
| Q |
105 |
gctgcgacacgtatgataatgtgtttataaatggtcgatggtctggttgcccgacagtctagcacatgcatcgtgtctctagttggggtatttagaactc |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187442 |
gctgcgacacgtatgataatgtgtttataaatggtcgatggtctggttgcccgacagtctagcacatgcatcgtgtctctagttggggtatttagaactc |
40187541 |
T |
 |
| Q |
205 |
tcgtacttgtaattgtaaattgtctggttgtttaacacatgatagtatagacgcatttgcaacctttcgtagaagatgtgatatt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187542 |
tcgtacttgtaattgtaaattgtctggttgtttaacacatgatagtatagacgcatttgcaacctttcgtagaagatgtgatatt |
40187626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 17 - 105
Target Start/End: Original strand, 40187295 - 40187383
Alignment:
| Q |
17 |
agctagatggatgaaggattttgtctatgccccgtgaatatttacaagtgaaaaatctcagtaatttttgttaaaattactttgacaag |
105 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40187295 |
agctagatggatgaaggattttgtctatgccccgtgaatatttacaagtgaaaaatctcagtaatttttgttaaaattactttgacaag |
40187383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University