View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3047_low_34 (Length: 250)

Name: NF3047_low_34
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3047_low_34
NF3047_low_34
[»] chr5 (1 HSPs)
chr5 (22-250)||(15054731-15054961)


Alignment Details
Target: chr5 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 22 - 250
Target Start/End: Complemental strand, 15054961 - 15054731
Alignment:
22 gaattttttgctttagtggatactatttgatgatttggtttacataagaacttttaactttaatcagnnnnnnnnnn--cttcagaaggaaaatgtttaa 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||            |||||||||||||||||||||    
15054961 gaattttttgctttagtggatactatttgatgatttggtttacataagaacttttaactttaatcagttttttttttttcttcagaaggaaaatgtttaa 15054862  T
120 tttaaaaaggctcgacaaaaaccaagttgaggatttaggctaggttgttaatagtggcaaattgtgctgcgataatagagcggatcagtgggtggccgcc 219  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||||||||||||||||||    
15054861 tttaaaaaggcttgacaaaaaccaagttgaggatttaggctaggttgttaatagtggcaaatcgtattgcgataatagagcggatcagtgggtggccgcc 15054762  T
220 ccaacatgctatgtatgagagtggcggccac 250  Q
    |||||||||| ||||||||||||||||||||    
15054761 ccaacatgctgtgtatgagagtggcggccac 15054731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University