View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3047_low_41 (Length: 221)
Name: NF3047_low_41
Description: NF3047
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3047_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 13 - 206
Target Start/End: Original strand, 8085492 - 8085685
Alignment:
| Q |
13 |
gagatgaaaaggagtgaagattttgttataaaaatgggtttggatagtggaattatagatatgagtttcaatgatttcttcagcttcgaaagcgacgtta |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
8085492 |
gagatgaaaaggagtgaagattttgttatgaaaatgggtttgaatagtggaattatagatatgagtttcaatgatttcttcagcttcgaaagtgacgtta |
8085591 |
T |
|
| Q |
113 |
cgaatctcggaaacccacatacgaacacgttcgttggattgttgtttagcgtcagcatctttgaggaaacattgcatccatgatagttggtttt |
206 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8085592 |
cgaatatcggaaacccacatacgaacacgttcgttggattgttgtttagcgtcagcatctttgaggaaacattgcatccatgatagttggtttt |
8085685 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University