View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048-Insertion-14 (Length: 300)
Name: NF3048-Insertion-14
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048-Insertion-14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 237; Significance: 1e-131; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 8 - 298
Target Start/End: Original strand, 2872327 - 2872629
Alignment:
| Q |
8 |
tgttaatacatatatttttcttttagagttgggattgagattccaacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtgggaa |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872327 |
tgttaatacatatatttttcttttagagttgggattgagattccaacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtgggaa |
2872426 |
T |
|
| Q |
108 |
gtagagcattacctagtttcacaaactttacaattggtgcagtggaggtaaatttcagcacaatctagc------------gtttcttatttagannnnn |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
2872427 |
gtagagcattacctagtttcacaaactttactattggtgcagtggaggtaaatttcagcacaatctagctcatatacttgtgtttcttatttagattttt |
2872526 |
T |
|
| Q |
196 |
nnggttagatatggtgtcaatcctataataaaattatgattgttcaaccttaaaccctacaaaagttttgtttgttattcatgttttgataaacaacctt |
295 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2872527 |
ttggttagatatggtgtcaatcctataataaaattatgattgttcaaccttaaaccctacaaaagttttgtttgttattcatgttttgataaacaacctt |
2872626 |
T |
|
| Q |
296 |
aat |
298 |
Q |
| |
|
||| |
|
|
| T |
2872627 |
aat |
2872629 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 25 - 106
Target Start/End: Original strand, 2882561 - 2882642
Alignment:
| Q |
25 |
ttcttttagagttgggattgagattccaacaattgaagttcgttttgagcacctaactattgaggcagaggcttatgtggga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| | | ||||||||||| | |||||||||| |||| ||||||| |
|
|
| T |
2882561 |
ttcttttagagttgggattgagattccagcaattgaagttagatatgagcacctaaatgttgaggcagaagcttttgtggga |
2882642 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 25 - 64
Target Start/End: Complemental strand, 2902452 - 2902413
Alignment:
| Q |
25 |
ttcttttagagttgggattgagattccaacaattgaagtt |
64 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
2902452 |
ttcttttagagttggtattgagattccaacaatagaagtt |
2902413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University