View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048-Insertion-16 (Length: 207)
Name: NF3048-Insertion-16
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048-Insertion-16 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 7 - 207
Target Start/End: Complemental strand, 3099761 - 3099561
Alignment:
| Q |
7 |
aataacccttcatgtttataagtacccttttcattggtgtccctataggactcaaaaaccttggtgatataaaagatgttggtgtccatgcatttgatga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3099761 |
aataacccttcatgtttataagtacccttttcattggtgtccctataggactcaaaaaccttggtgatataaaagatgttggtgtccatgcatttgatga |
3099662 |
T |
|
| Q |
107 |
tttagcttcctttgatccttgtcttggtgacctttgtcctgatggtgtcagtatctctggtgttgacactcttggtgttgctggtattgatatcagctct |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3099661 |
tttagcttcctttgatccttgtcttggtgacctttgtcctgatggtgtcagtatctctggtgttgacactcttggtgttgctggtattgatatcagctct |
3099562 |
T |
|
| Q |
207 |
g |
207 |
Q |
| |
|
| |
|
|
| T |
3099561 |
g |
3099561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University