View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048-Insertion-18 (Length: 148)
Name: NF3048-Insertion-18
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048-Insertion-18 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 2e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 2e-62
Query Start/End: Original strand, 5 - 148
Target Start/End: Original strand, 17270197 - 17270338
Alignment:
| Q |
5 |
acaagaatctaatgtcttaattttattattcttatgtaagtgaatatatcttctctaattaaagtgattatactatagttttaaattgcaatttgcaact |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17270197 |
acaagactctaatgtcttaattttattattcttatgtaaatgaatatatcttctctaattaaagtgatta--ctatagttttaaattgcaatttgcaact |
17270294 |
T |
 |
| Q |
105 |
cacatataaatattttagaggttttacattgctatcacaaccgt |
148 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17270295 |
cacatataaatattttagaggttttatattgctatcacaaccgt |
17270338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University