View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048-Insertion-19 (Length: 142)
Name: NF3048-Insertion-19
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048-Insertion-19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 2e-53; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 2e-53
Query Start/End: Original strand, 7 - 134
Target Start/End: Complemental strand, 15886392 - 15886259
Alignment:
| Q |
7 |
aatcttatctttgataaaactgaaagttgctttcttacttcttccgatcgaagaaggtcagcctagatatttacc-gtaccaagaacaa-----acccaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |
|
|
| T |
15886392 |
aatcttatctttgataaaactgaaagttgctttcttacttcttccgatcgaagaaggtcagcctagatatttaccggtaccaagaacaacctggacccaa |
15886293 |
T |
|
| Q |
101 |
gcttgtttgctatgtttttatgcgatgttgtgat |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
15886292 |
gcttgtttgctatgtttttatgcgatgttgtgat |
15886259 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000002
Query Start/End: Original strand, 14 - 55
Target Start/End: Complemental strand, 34672002 - 34671961
Alignment:
| Q |
14 |
tctttgataaaactgaaagttgctttcttacttcttccgatc |
55 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34672002 |
tctttgataaaattgaaagttgatttcttacttcttccgatc |
34671961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University