View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048-Insertion-20 (Length: 184)
Name: NF3048-Insertion-20
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048-Insertion-20 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 173; Significance: 3e-93; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 8 - 184
Target Start/End: Original strand, 2551894 - 2552070
Alignment:
| Q |
8 |
aggtaagcgttgaatccataaatcaaattgttgtgacctttgaatagttccttgacagcagctatgacaccatgagtgtcagtcctggaaacaatcacca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551894 |
aggtaagcgttgaatccataaatcaaattgttgtgacctttgaatagttccttgacagcagctatgacaccatgagtgtcagtcctggaaacaatcacca |
2551993 |
T |
|
| Q |
108 |
caaaaaatatcaagatcccttgattgtaagcacaatgttccacatttcaaaatcattatcaaacgtaaaaataaggt |
184 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2551994 |
caaaaaatatcgagatcccttgattgtaagcacaatgttccacatttcaaaatcattatcaaacgtaaaaataaggt |
2552070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 45; E-Value: 7e-17
Query Start/End: Original strand, 20 - 100
Target Start/End: Original strand, 2534616 - 2534696
Alignment:
| Q |
20 |
aatccataaatcaaattgttgtgacctttgaatagttccttgacagcagctatgacaccatgagtgtcagtcctggaaaca |
100 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||| |
|
|
| T |
2534616 |
aatccaaaaatcaaatggttgtgacctttgaatagttccttaacccttgctatgacaccagtagtgtcagtcctggaaaca |
2534696 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 20 - 100
Target Start/End: Complemental strand, 22919812 - 22919732
Alignment:
| Q |
20 |
aatccataaatcaaattgttgtgacctttgaatagttccttgacagcagctatgacaccatgagtgtcagtcctggaaaca |
100 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||||||||| || ||||| |||||| ||||||||||||||||||| |
|
|
| T |
22919812 |
aatccaaaaatcaaatggttgtgacctttgaatagttccttaacccttgctataacaccagtagtgtcagtcctggaaaca |
22919732 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University