View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048R-Insertion-12 (Length: 275)
Name: NF3048R-Insertion-12
Description: NF3048R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048R-Insertion-12 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 9 - 275
Target Start/End: Complemental strand, 39893394 - 39893128
Alignment:
| Q |
9 |
aaagcctctttgaccttaaaatctcttgcacgcagaaatttcaacagaattacgtcacttctttcgtcagcaaggagtggtatcccataaatggatactt |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39893394 |
aaagcctctttgaccttaaaatctcttgcacgcagaaatttcaacagaattacgtcacttgtttcgtcagcaaggagtggtatcccataaatggatactt |
39893295 |
T |
|
| Q |
109 |
gttcaggtggtaatggcaacgacgcttcaactttctcgacaacaggttcttgctctggaggaacagaggcagaaaccgcaacaatgctttcttcaatagc |
208 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39893294 |
gttcaggtggtaatggcaatgacgcttcaactttctcgacaacaggtttttgctctggaggaacagatgcagaaaccgcaacaatgctttcttcaatagc |
39893195 |
T |
|
| Q |
209 |
ctccacagtttttgctccatcatcctccacagaagacactacattttccttcttatcttctacttgg |
275 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
39893194 |
ctccacagtttttgctccatcatcctccacagaagacactacattttccttcttatcttctaattgg |
39893128 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University