View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048R-Insertion-6 (Length: 127)
Name: NF3048R-Insertion-6
Description: NF3048R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048R-Insertion-6 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 82; Significance: 4e-39; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 82; E-Value: 4e-39
Query Start/End: Original strand, 46 - 127
Target Start/End: Original strand, 55123950 - 55124031
Alignment:
| Q |
46 |
tattttgaattattattggcactaagcaacattattgtcattattcgatattgttgatgttacctgattgttgtcgctttca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123950 |
tattttgaattattattggcactaagcaacattattgtcattattcgatattgttgatgttacctgattgttgtcgctttca |
55124031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 38; E-Value: 0.0000000000007
Query Start/End: Original strand, 9 - 46
Target Start/End: Original strand, 55123888 - 55123925
Alignment:
| Q |
9 |
atatgtagagggagttactgctgcaactaagaatattt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55123888 |
atatgtagagggagttactgctgcaactaagaatattt |
55123925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University