View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048R-Insertion-7 (Length: 159)
Name: NF3048R-Insertion-7
Description: NF3048R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048R-Insertion-7 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 112; Significance: 6e-57; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 112; E-Value: 6e-57
Query Start/End: Original strand, 29 - 159
Target Start/End: Original strand, 45283780 - 45283908
Alignment:
| Q |
29 |
gatagatagatatgtttaaagtcaaatatggggttagtgatttagaggttgtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctgg |
128 |
Q |
| |
|
||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45283780 |
gatagatagatatctttaaagtcaaatatgg--ttagtgatttagaggttgtacaaaatgtgcattaaatcaatgtatatgtttccagattataagctgg |
45283877 |
T |
|
| Q |
129 |
agattttggggttttgactttcttgagactc |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
45283878 |
cgattttggggttttgactttcttgagactc |
45283908 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University