View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048R-Insertion-8 (Length: 203)
Name: NF3048R-Insertion-8
Description: NF3048R
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048R-Insertion-8 |
 | |
|
| [»] chr2 (3 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 191; Significance: 1e-104; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 9 - 203
Target Start/End: Original strand, 34216776 - 34216970
Alignment:
| Q |
9 |
acaaagcctataacttttcatttgtgattactgagaaggaaatttcttatggatatgaacttttgaacaagtctgttgtttcaagatacttggtatcttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216776 |
acaaagcctataacttttcatttgtgattactgagaaggaaatttcttatggatatgaacttttgaacaagtctgttgtttcaagatacttggtatcttc |
34216875 |
T |
|
| Q |
109 |
aactggtcaaatagcgcgatacatgttgtcgaatcagacaaatagttggcaacttttctttgtcggacctgcagacagttgtgataattatgcta |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34216876 |
aactggtcaaatagcgcgatacatgttgtcggatcagacaaatagttggcaacttttctttgtcggacctgcagacagttgtgataattatgcta |
34216970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 24 - 171
Target Start/End: Complemental strand, 34194785 - 34194638
Alignment:
| Q |
24 |
tttcatttgtgattactgagaaggaaatttcttatggatatgaacttttgaacaagtctgttgtttcaagatacttggtatcttcaactggtcaaatagc |
123 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||| ||||||| |||||||||| ||| || || || ||| |||||| || | |
|
|
| T |
34194785 |
tttcatttgtgattactgaaaaggaagtttcttatggatatgaacttttggacaagtccattgtttcaaggtacatgctaactccaatcggtcaagtatc |
34194686 |
T |
|
| Q |
124 |
gcgatacatgttgtcgaatcagacaaatagttggcaacttttctttgt |
171 |
Q |
| |
|
||| ||||||||||| |||||||||| |||||||||||| ||||||| |
|
|
| T |
34194685 |
gcgttacatgttgtccgatcagacaaagagttggcaacttgtctttgt |
34194638 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 36 - 73
Target Start/End: Original strand, 34205378 - 34205415
Alignment:
| Q |
36 |
ttactgagaaggaaatttcttatggatatgaacttttg |
73 |
Q |
| |
|
||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
34205378 |
ttactgagacggaagtttcttatggatatgaacttttg |
34205415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University