View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_high_37 (Length: 247)
Name: NF3048_high_37
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_high_37 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 109; Significance: 6e-55; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 109; E-Value: 6e-55
Query Start/End: Original strand, 13 - 121
Target Start/End: Original strand, 52441485 - 52441593
Alignment:
| Q |
13 |
aagaagaaatggtgactcacgagaagcttgttaagacactctacgctatttctctctctagtcagactcagaactgcctctacaaatttctatgagtgac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52441485 |
aagaagaaatggtgactcacgagaagcttgttaagacactctacgctatttctctctctagtcagactcagaactgcctctacaaatttctatgagtgac |
52441584 |
T |
 |
| Q |
113 |
tttcatccc |
121 |
Q |
| |
|
||||||||| |
|
|
| T |
52441585 |
tttcatccc |
52441593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 189 - 247
Target Start/End: Original strand, 52441662 - 52441720
Alignment:
| Q |
189 |
caaactctgtaaaccatttgatcttgatttaacgatcatgattatcgtggagtgtaaat |
247 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
52441662 |
caaactttgtaaaccatttgatctcgatttaacgatcatgattatcatggagtgtaaat |
52441720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University