View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_high_45 (Length: 237)
Name: NF3048_high_45
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_high_45 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 164; Significance: 9e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 164; E-Value: 9e-88
Query Start/End: Original strand, 16 - 232
Target Start/End: Original strand, 31263921 - 31264137
Alignment:
| Q |
16 |
gtggtggtgatgggaaaacatcgtctagatactccttatgcgcaacaggtgtaggctcaaccacttatgaggagtttgactcatcgnnnnnnngagtctg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |
|
|
| T |
31263921 |
gtggtggtgatgggaaaacatcgtctagatactccttatgcgcaacaggtgtaggctcaaccacttatgaggagtttgactcatcgtcgttttgagtcag |
31264020 |
T |
 |
| Q |
116 |
atgcctacgtcagtcccgtttagggggaggattaactgcatcatttaccttacatacaaagttatgttggctctacctaccgagtagaagcctaccaacg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
31264021 |
atgcctacgtcagtcccgtttagggggaggattaactgcatcatttgccttacatacaaagttatgttgactctacctaccgagtcgaagcctaccaaca |
31264120 |
T |
 |
| Q |
216 |
tcgttagaattatctac |
232 |
Q |
| |
|
|||| ||| ||||||| |
|
|
| T |
31264121 |
tcgtcagatatatctac |
31264137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University