View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_high_52 (Length: 212)
Name: NF3048_high_52
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_high_52 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 18 - 196
Target Start/End: Complemental strand, 10871043 - 10870865
Alignment:
| Q |
18 |
ttaattgggatcaaaattttttattatgacttattatgcaagtaacattgattgttttcttttgattagaggagactcaattcaatttcgttttttgtga |
117 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||| |
|
|
| T |
10871043 |
ttaattgggatcaaaaaaatttattatgacttattatgcaagtaacattgattgtttccttttgattagaggagactcaattcgatttcgttttttatga |
10870944 |
T |
|
| Q |
118 |
ttttctgaaaattttaatctatcagtttgtttctactttatctgtataattcataacttgtgctgtctttgaggatttt |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10870943 |
ttttctgaaaattttaatctatcagtttgtttctactttatctgtataattcataacttgtgctgtctttgaggatttt |
10870865 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 70
Target Start/End: Original strand, 14944291 - 14944328
Alignment:
| Q |
33 |
attttttattatgacttattatgcaagtaacattgatt |
70 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14944291 |
attttttattatgacttattatgcaagtaacactgatt |
14944328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University