View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_high_8 (Length: 452)
Name: NF3048_high_8
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_high_8 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 423; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 423; E-Value: 0
Query Start/End: Original strand, 19 - 452
Target Start/End: Complemental strand, 52585171 - 52584737
Alignment:
| Q |
19 |
ttgacaccatatcccaagtggtcataaatttaagtatgattttggcatgtgcagtgtatagtaatagtactcctccaagttagttt-gagctatcacatt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
52585171 |
ttgacaccatatcccaagtggtcataaatttaagtatgattttggcatgtgcagtgtatagtaatagtactcctccaagttagttttgagctatcacatt |
52585072 |
T |
 |
| Q |
118 |
tatcttactgaatactagagctgcaatattcaaacatgaaacttgggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacctca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52585071 |
tatcttactgaatactagagctgcaatattcaaacatgaaacttgggatttgattgtgaccactgattatgctcaccaatgaatccactgctcaacctca |
52584972 |
T |
 |
| Q |
218 |
atagggcttcgtgcacctagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584971 |
atagggcttcgtgcacctagtacggattcaccacttctatgttaatgtcttattaactcatgtcttcagaatatatactatactagcttttttgctcaaa |
52584872 |
T |
 |
| Q |
318 |
tagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctctttttccataaaaatctctcttctttcact |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
52584871 |
tagtttcttcagtacgtaaaaaacagtgttgattcgattcgattcgattccccctttcactccttttctccttttccataaaaatctctcttctttcact |
52584772 |
T |
 |
| Q |
418 |
gttctagagagatccacatcacaaaactcacatgc |
452 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52584771 |
gttctagagagatccacatcacaaaactcacatgc |
52584737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University