View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3048_low_26 (Length: 328)
Name: NF3048_low_26
Description: NF3048
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3048_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 1e-84; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 105 - 310
Target Start/End: Complemental strand, 14342757 - 14342550
Alignment:
| Q |
105 |
taattttcaacctatagaaaaagaaggttattttgtctaaaatacaaaaagaaggttataaataatagagcat---atgttatatttgttacaatagatg |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| ||| |
|
|
| T |
14342757 |
taattttcaacctatagaaaaagaaggttattctgtctaaaataaaaaaagaaggttataaataatagagcatcgaatgttatatttgttacaatatatg |
14342658 |
T |
 |
| Q |
202 |
taaccgattaaaagcaaacgttaaatttttaaagaacttttatgttgttttaaacaaacaaataaaatttacatcaatagtgtccacgtgagcttaactc |
301 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
14342657 |
taaccgattaaaagcaaacgttaaatttt-aaagaacttttaagttgttttaaacaaacaaataaaatttatatcaatagtgtctccgtgagcttaactc |
14342559 |
T |
 |
| Q |
302 |
agttggtag |
310 |
Q |
| |
|
||||||||| |
|
|
| T |
14342558 |
agttggtag |
14342550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 2 - 67
Target Start/End: Complemental strand, 14342852 - 14342787
Alignment:
| Q |
2 |
gcatgtcgaagaatatccctttaatttcgttgttttattttctctttggactatgccctcttttgt |
67 |
Q |
| |
|
||||||| ||||| || ||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14342852 |
gcatgtctaagaacgtctctttaatttcgttcttttattttctctttggactatgccctcttttgt |
14342787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 283 - 311
Target Start/End: Original strand, 30938385 - 30938413
Alignment:
| Q |
283 |
gtccacgtgagcttaactcagttggtagg |
311 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
30938385 |
gtccacgtgagcttaactcagttggtagg |
30938413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 281 - 309
Target Start/End: Complemental strand, 32950830 - 32950802
Alignment:
| Q |
281 |
gtgtccacgtgagcttaactcagttggta |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32950830 |
gtgtccacgtgagcttaactcagttggta |
32950802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University